View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2214_low_6 (Length: 237)
Name: NF2214_low_6
Description: NF2214
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2214_low_6 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 221; Significance: 1e-122; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 1 - 237
Target Start/End: Complemental strand, 51740347 - 51740111
Alignment:
| Q |
1 |
cgttacaaatactataaaccccaacatcactgacattactgcatttattgatgtccaaaaacttgatccgttggcaaccacttgcaaggctcatcagccc |
100 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51740347 |
cgttacaaatactagaaaccccaacatcactgacagtactgcatttattgatgtccaaaaacttgatccgttggcaaccacttgcaaggctcatcagccc |
51740248 |
T |
 |
| Q |
101 |
attgtcagtgatacttgtgcatccttgcaataccaactcttctaaattacgacagtttttggacagagcttctagtatactattcgtaacaaatctgcac |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
51740247 |
attgtcagtgatacttgtgcatccttgcaataccaactcttctaaattacgacagtttttggacagagcttctagtatactatccgtaacaaatctgcac |
51740148 |
T |
 |
| Q |
201 |
ccagtaagatgcaatatccacaggtcgcaacagcctt |
237 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
51740147 |
ccagtaagatgcaatatccgcaggtcgcaacagcctt |
51740111 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University