View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2214_low_7 (Length: 233)
Name: NF2214_low_7
Description: NF2214
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2214_low_7 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 140; Significance: 2e-73; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 14 - 233
Target Start/End: Complemental strand, 2833589 - 2833368
Alignment:
| Q |
14 |
tcaaaatcatccaatcaaactttaggacatggctagggttggttattatccgtcccttgcgcacccctagatatcgtgttcgaaacttcaaaaatatagt |
113 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| | ||||||| ||| |||||||||||||||| ||||| |
|
|
| T |
2833589 |
tcaaaatcatccaatcaaa-tttaggacatggctagggttggttattatccgtcccttgcgcatctctagataccgtattcgaaacttcaaaaaaatagt |
2833491 |
T |
|
| Q |
114 |
ttnnnnnnn---gttgtaaatacatattttcttctcacattagggaaaaatgcgagaagaaaataaagttcttcatctttttgtgaggcaatgtcagtgg |
210 |
Q |
| |
|
| | |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2833490 |
taaaaaaaaaaaggtgtaaatacatattttcttctcgcattagggaaaaatgcgagaagaaaataaagttcttcatctttttgtgaggcaatgtcagtgg |
2833391 |
T |
|
| Q |
211 |
tggacagagtgaaactcttagct |
233 |
Q |
| |
|
| || |||||||||||||||||| |
|
|
| T |
2833390 |
tagatagagtgaaactcttagct |
2833368 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University