View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2214_low_7 (Length: 233)

Name: NF2214_low_7
Description: NF2214
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2214_low_7
NF2214_low_7
[»] chr3 (1 HSPs)
chr3 (14-233)||(2833368-2833589)


Alignment Details
Target: chr3 (Bit Score: 140; Significance: 2e-73; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 14 - 233
Target Start/End: Complemental strand, 2833589 - 2833368
Alignment:
14 tcaaaatcatccaatcaaactttaggacatggctagggttggttattatccgtcccttgcgcacccctagatatcgtgttcgaaacttcaaaaatatagt 113  Q
    ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| | ||||||| ||| |||||||||||||||| |||||    
2833589 tcaaaatcatccaatcaaa-tttaggacatggctagggttggttattatccgtcccttgcgcatctctagataccgtattcgaaacttcaaaaaaatagt 2833491  T
114 ttnnnnnnn---gttgtaaatacatattttcttctcacattagggaaaaatgcgagaagaaaataaagttcttcatctttttgtgaggcaatgtcagtgg 210  Q
    |           | |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
2833490 taaaaaaaaaaaggtgtaaatacatattttcttctcgcattagggaaaaatgcgagaagaaaataaagttcttcatctttttgtgaggcaatgtcagtgg 2833391  T
211 tggacagagtgaaactcttagct 233  Q
    | || ||||||||||||||||||    
2833390 tagatagagtgaaactcttagct 2833368  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University