View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2215_low_15 (Length: 257)
Name: NF2215_low_15
Description: NF2215
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2215_low_15 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 18 - 241
Target Start/End: Complemental strand, 51294570 - 51294351
Alignment:
| Q |
18 |
gattattggtaggaaaaacaagaatgaacgaagaagttaaaatgaaatttcaagaagcaatttgttgctcagaatcagtggctcggttggcatagaatct |
117 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51294570 |
gattattggtaggaaaaacaagaatgaa----gaagttaaaatgaaatttcaagaagcaatttgttgctcagaatcagtggctcggttggcatagaatct |
51294475 |
T |
 |
| Q |
118 |
agcaatgaaagcagaagctttcttgtcaataccaggctcagcaacccaacgacctctgtcttcatcacttgcaaatatccttctgctactgccatcatca |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51294474 |
agcaatgaaagcagaagctttcttgtcaataccaggctcagcaacccaacgacctctgtcttcatcacttgcaaatatccttctgctactgccatcatca |
51294375 |
T |
 |
| Q |
218 |
tcataatagtaataatcatcccta |
241 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
51294374 |
tcataatagtaataatcatcccta |
51294351 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 60; Significance: 1e-25; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 114 - 201
Target Start/End: Original strand, 19574945 - 19575032
Alignment:
| Q |
114 |
atctagcaatgaaagcagaagctttcttgtcaataccaggctcagcaacccaacgacctctgtcttcatcacttgcaaatatccttct |
201 |
Q |
| |
|
|||||||||||||| ||||||||||| | ||||||||||||||||||||||||| |||||| ||||||||||||||||| || ||||| |
|
|
| T |
19574945 |
atctagcaatgaaatcagaagctttcctatcaataccaggctcagcaacccaacaacctctatcttcatcacttgcaaacattcttct |
19575032 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University