View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2215_low_19 (Length: 247)
Name: NF2215_low_19
Description: NF2215
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2215_low_19 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 17 - 231
Target Start/End: Complemental strand, 47318979 - 47318765
Alignment:
| Q |
17 |
aaagtttcttcgaaagtaaaagtgttgaaattgctggttttgctcagaatcaacaatatggacttggtggaaattctcttactggtggtcagaaaactgt |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
47318979 |
aaagtttcttcgaaagtaaaagtgttgaaattgctggttttgctcagaatcaacaatatggacttggtggaaattctctcactggtggtcagaaaactgt |
47318880 |
T |
 |
| Q |
117 |
gcttatttatggtactttgttgtttttctttgccctttttctcagtggctacttcatacaatagtgttattattcattctcatcttatcaatcaaattac |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47318879 |
gcttatttatggtactttgttgtttttctttgccctttttctcagtggctacttcatacaatagtgttattattcattctcatcttatcaatcaaattac |
47318780 |
T |
 |
| Q |
217 |
tcctctcatttctga |
231 |
Q |
| |
|
| ||||||||||||| |
|
|
| T |
47318779 |
ttctctcatttctga |
47318765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University