View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2215_low_26 (Length: 217)
Name: NF2215_low_26
Description: NF2215
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2215_low_26 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 130; Significance: 2e-67; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 1 - 198
Target Start/End: Complemental strand, 8135121 - 8134920
Alignment:
| Q |
1 |
cacgtcgacacatatatcagacacaacattgataaatacgtatatacacttctaataatttaagnnnnnnnnn----gcgattgaatgtacatgtgtggg |
96 |
Q |
| |
|
||||||||||| |||||||||||||||||||||| ||||| ||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
8135121 |
cacgtcgacacgtatatcagacacaacattgatacatacgcatatacacttctaataatttaagagaaaaaaaaaaagcgattgaatgtacatgtgtggg |
8135022 |
T |
 |
| Q |
97 |
tgatgtgttagtgtccaacattagcatgcctcggacaccaaacacattttcaatcttaaatttcagtgcaacatataatcaaacactatttctaatcgat |
196 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
8135021 |
tgatgtgttagtgtccaacattagcatgccttggacgccaaacacattttcaatctgaaatttcagtgcaacatataatcaaacactatttctaatcaat |
8134922 |
T |
 |
| Q |
197 |
ca |
198 |
Q |
| |
|
|| |
|
|
| T |
8134921 |
ca |
8134920 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 85 - 151
Target Start/End: Complemental strand, 8134648 - 8134582
Alignment:
| Q |
85 |
tacatgtgtgggtgatgtgttagtgtccaacattagcatgcctcggacaccaaacacattttcaatc |
151 |
Q |
| |
|
|||||| |||| || ||||||||| ||||||| ||||||| ||||||||||| ||| || ||||||| |
|
|
| T |
8134648 |
tacatgcgtggatgttgtgttagtatccaacactagcatgtctcggacaccagacatatattcaatc |
8134582 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University