View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2216_low_11 (Length: 237)
Name: NF2216_low_11
Description: NF2216
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2216_low_11 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 1 - 225
Target Start/End: Complemental strand, 9966571 - 9966347
Alignment:
| Q |
1 |
gttttatagctgcagtatgccactatcttttttggatgttttcggtaggtctttcaattccataccttcttatctgctgaagctaactcagtatatttgt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9966571 |
gttttatagctgcagtatgccactatcttttttggatgttttcggtaggtctttcaattccataccttcttatctgctgaagctaactcagtatatttgt |
9966472 |
T |
 |
| Q |
101 |
agtttgaaaaagctatgaatcaatgaattcttttcaccaggcaaatcatatttgactgacagaaccattcaaattcatgaaatattgcagatgtcactat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9966471 |
agtttgaaaaagctatgaatcaatgaattcttttcaccaggcaaatcataattgactgacaaaaccattcaaattcatgaaatattgcagatgtcactat |
9966372 |
T |
 |
| Q |
201 |
tcgtgcttaaatattgttgaaactg |
225 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
9966371 |
tcgtgcttaaatattgttgaaactg |
9966347 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University