View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2216_low_9 (Length: 244)

Name: NF2216_low_9
Description: NF2216
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2216_low_9
NF2216_low_9
[»] chr2 (2 HSPs)
chr2 (102-187)||(27253681-27253766)
chr2 (11-60)||(27253590-27253639)


Alignment Details
Target: chr2 (Bit Score: 53; Significance: 2e-21; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 102 - 187
Target Start/End: Original strand, 27253681 - 27253766
Alignment:
102 gcatgaatcacatgaaacaagaattgggaggacaaaaatcacatnnnnnnntaaaagctttaaagtagtagtaagagaagtcatca 187  Q
    |||||||||||||||||||||||||||||||| |||||||||||       |||||||||||| ||||||||||||||| ||||||    
27253681 gcatgaatcacatgaaacaagaattgggaggataaaaatcacataaaaaaataaaagctttaaggtagtagtaagagaactcatca 27253766  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 11 - 60
Target Start/End: Original strand, 27253590 - 27253639
Alignment:
11 cacagacaaggacagaagcaattgaaccaagtttgtattgaagggcttca 60  Q
    |||| ||||||||||| |||||||||||||||||||| ||||||||||||    
27253590 cacaaacaaggacagatgcaattgaaccaagtttgtaatgaagggcttca 27253639  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University