View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2216_low_9 (Length: 244)
Name: NF2216_low_9
Description: NF2216
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2216_low_9 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 53; Significance: 2e-21; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 102 - 187
Target Start/End: Original strand, 27253681 - 27253766
Alignment:
| Q |
102 |
gcatgaatcacatgaaacaagaattgggaggacaaaaatcacatnnnnnnntaaaagctttaaagtagtagtaagagaagtcatca |
187 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||| |||||||||||| ||||||||||||||| |||||| |
|
|
| T |
27253681 |
gcatgaatcacatgaaacaagaattgggaggataaaaatcacataaaaaaataaaagctttaaggtagtagtaagagaactcatca |
27253766 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 11 - 60
Target Start/End: Original strand, 27253590 - 27253639
Alignment:
| Q |
11 |
cacagacaaggacagaagcaattgaaccaagtttgtattgaagggcttca |
60 |
Q |
| |
|
|||| ||||||||||| |||||||||||||||||||| |||||||||||| |
|
|
| T |
27253590 |
cacaaacaaggacagatgcaattgaaccaagtttgtaatgaagggcttca |
27253639 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University