View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2217_low_5 (Length: 304)
Name: NF2217_low_5
Description: NF2217
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2217_low_5 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 101 - 288
Target Start/End: Complemental strand, 51555436 - 51555249
Alignment:
| Q |
101 |
aagaaattagaaataatgggtcacgaaaattacgaagaaaagagatgaatttagagaaacccattaacctgaagttgttctacgggtaaaggaccgtgtt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51555436 |
aagaaattagaaataatgggtcacgaaaattacgaagaaaagagatgaatttagagaaacccattaacctgaagttgttctacgggtaaaggaccgtgtt |
51555337 |
T |
|
| Q |
201 |
gaatctcttcggtttcttggtcgtgttgttgtgctgttttctcaagtcgttgttgctccatggtttaaagattcgatctttttcgaag |
288 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51555336 |
gaatctcttccgtttcttggtcgtgttgttgtgctgttttctcaagtcgttgttgctccatggtttaaagattcgatctttttcgaag |
51555249 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University