View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2218-Insertion-11 (Length: 122)
Name: NF2218-Insertion-11
Description: NF2218
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2218-Insertion-11 |
 |  |
|
| [»] chr7 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 115; Significance: 7e-59; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 115; E-Value: 7e-59
Query Start/End: Original strand, 8 - 122
Target Start/End: Complemental strand, 4251070 - 4250956
Alignment:
| Q |
8 |
taagcttctatcatttcctttttcacttgggaataatgtggatacaaggtccattacgttatttccatttgggtctttgatgacttccctattgaatgaa |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4251070 |
taagcttctatcatttcctttttcacttgggaataatgtggatacaaggtccattacgttatttccatttgggtctttgatgacttccctattgaatgaa |
4250971 |
T |
 |
| Q |
108 |
ggttcgaactctgac |
122 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
4250970 |
ggttcgaactctgac |
4250956 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 32; E-Value: 0.000000002
Query Start/End: Original strand, 65 - 104
Target Start/End: Complemental strand, 4246578 - 4246539
Alignment:
| Q |
65 |
gttatttccatttgggtctttgatgacttccctattgaat |
104 |
Q |
| |
|
|||||||||||||||||||||||||| |||||| |||||| |
|
|
| T |
4246578 |
gttatttccatttgggtctttgatgatttccctgttgaat |
4246539 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University