View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2218-Insertion-8 (Length: 196)
Name: NF2218-Insertion-8
Description: NF2218
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2218-Insertion-8 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 118; Significance: 2e-60; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 118; E-Value: 2e-60
Query Start/End: Original strand, 7 - 168
Target Start/End: Original strand, 41946048 - 41946207
Alignment:
| Q |
7 |
atacccaacaattgcataccttacagcgttgctccggcgggaggaatgaaaaactcttgtcattgatcaagttcttccaatgcttctctggaatgaagaa |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||| ||||||||||||||| |||||||| ||||| |||||| |
|
|
| T |
41946048 |
atacccaacaattgcataccttacagcgttgctccggctggaggaatgaaaaactct-gtctttgatcaagttcttc-aatgcttccttggaacgaagaa |
41946145 |
T |
|
| Q |
107 |
gattatccattaagatggattgatgattgtaatgtacatcaaacttgggtattgacggttgc |
168 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
41946146 |
gattatccattaagatggattaatgattgtaatgtacatcaaacttgggtattgacgcttgc |
41946207 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University