View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2218-Insertion-9 (Length: 178)
Name: NF2218-Insertion-9
Description: NF2218
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2218-Insertion-9 |
 | |
|
| [»] scaffold0543 (1 HSPs) |
| | |
|
| [»] scaffold0492 (1 HSPs) |
| | |
|
Alignment Details
Target: chr3 (Bit Score: 126; Significance: 3e-65; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 126; E-Value: 3e-65
Query Start/End: Original strand, 9 - 138
Target Start/End: Complemental strand, 49856991 - 49856862
Alignment:
| Q |
9 |
gtgtttcacaatttaacccatctggagcttagattggactttatgcataatcgtgggatgttgaagtggagctggctgataaaactgcttcaaaatttcc |
108 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49856991 |
gtgtttcacaatttaacccacctggagcttagattggactttatgcataatcgtgggatgttgaagtggagctggctgataaaactgcttcaaaatttcc |
49856892 |
T |
|
| Q |
109 |
ccctgcttcaaactcttattattgaggagg |
138 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
49856891 |
ccctgcttcaaactcttattattgaggagg |
49856862 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 34; E-Value: 0.0000000002
Query Start/End: Original strand, 10 - 127
Target Start/End: Complemental strand, 49868368 - 49868251
Alignment:
| Q |
10 |
tgtttcacaatttaacccatctggagcttagattggactttatgcataatcgtgggatgttgaagtggagctggctgataaaactgcttcaaaatttccc |
109 |
Q |
| |
|
||||||| ||||||||||| ||| |||||| ||| |||||||||| | | |||| || | ||||||| ||||||||| |||||||| |||||||||| |
|
|
| T |
49868368 |
tgtttcataatttaacccacctgaagcttatattcgactttatgcgtccacttgggttgctcaagtggaactggctgattgaactgcttgaaaatttccc |
49868269 |
T |
|
| Q |
110 |
cctgcttcaaactcttat |
127 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
49868268 |
taaacttcaaactcttat |
49868251 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 10 - 49
Target Start/End: Original strand, 39559396 - 39559435
Alignment:
| Q |
10 |
tgtttcacaatttaacccatctggagcttagattggactt |
49 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||| ||||| |
|
|
| T |
39559396 |
tgtttcacaatttaacccatctggagcttatattagactt |
39559435 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0543 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: scaffold0543
Description:
Target: scaffold0543; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 10 - 138
Target Start/End: Complemental strand, 2501 - 2373
Alignment:
| Q |
10 |
tgtttcacaatttaacccatctggagcttagattggactttatgcata-atcgtgggatgttgaagtggagctggctgataaaactgcttcaaaatttcc |
108 |
Q |
| |
|
||||||||||||| ||||| || ||||||| ||| ||||||||||| ||| ||| |||||||||||||||| | || ||||||||| ||||||||| |
|
|
| T |
2501 |
tgtttcacaatttgacccaccttgagcttatattcaactttatgcattcatc-tggatcgttgaagtggagctggataatgaaactgcttgaaaatttcc |
2403 |
T |
|
| Q |
109 |
ccctgcttcaaactcttattattgaggagg |
138 |
Q |
| |
|
|| |||||||||||||| ||||| |||| |
|
|
| T |
2402 |
ccaaacttcaaactcttatcattgaagagg |
2373 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0492 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: scaffold0492
Description:
Target: scaffold0492; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 10 - 138
Target Start/End: Complemental strand, 4047 - 3919
Alignment:
| Q |
10 |
tgtttcacaatttaacccatctggagcttagattggactttatgcata-atcgtgggatgttgaagtggagctggctgataaaactgcttcaaaatttcc |
108 |
Q |
| |
|
||||||||||||| ||||| || ||||||| ||| ||||||||||| ||| ||| |||||||||||||||| | || ||||||||| ||||||||| |
|
|
| T |
4047 |
tgtttcacaatttgacccaccttgagcttatattcaactttatgcattcatc-tggatcgttgaagtggagctggataatgaaactgcttgaaaatttcc |
3949 |
T |
|
| Q |
109 |
ccctgcttcaaactcttattattgaggagg |
138 |
Q |
| |
|
|| |||||||||||||| ||||| |||| |
|
|
| T |
3948 |
ccaaacttcaaactcttatcattgaagagg |
3919 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University