View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2218R-Insertion-14 (Length: 181)
Name: NF2218R-Insertion-14
Description: NF2218R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2218R-Insertion-14 |
 |  |
|
| [»] chr1 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 169; Significance: 7e-91; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 169; E-Value: 7e-91
Query Start/End: Original strand, 9 - 181
Target Start/End: Complemental strand, 36309566 - 36309394
Alignment:
| Q |
9 |
cacaggtccaaagaagaaagatcgttctgaaaattctgttgccgttaaaacggtatcagtttggacatcagttagttgttcgtattcgcggtggttgaat |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36309566 |
cacaggtccaaagaagaaagatcgttctgaaaattctgttgccgttaaaacggtatcagtttggacatcagttagttgttcgtattcgcggtggttgaat |
36309467 |
T |
 |
| Q |
109 |
gtgacatgtggaggatctcttgcgtttagaagttctctatgccacgcaggttgaatcggaggttgttttgcac |
181 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36309466 |
gtgacatgtggaggatctcttgcgtttagaagctctctatgccacgcaggttgaatcggaggttgttttgcac |
36309394 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 28; E-Value: 0.0000009
Query Start/End: Original strand, 13 - 44
Target Start/End: Original strand, 36325459 - 36325490
Alignment:
| Q |
13 |
ggtccaaagaagaaagatcgttctgaaaattc |
44 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| |
|
|
| T |
36325459 |
ggtccaaagaagaaagattgttctgaaaattc |
36325490 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University