View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2218R-Insertion-15 (Length: 123)
Name: NF2218R-Insertion-15
Description: NF2218R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2218R-Insertion-15 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 107; Significance: 4e-54; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 107; E-Value: 4e-54
Query Start/End: Original strand, 9 - 123
Target Start/End: Complemental strand, 44221166 - 44221052
Alignment:
| Q |
9 |
aaattatggcatgaaatatgtggaaagctcacagtgcaggtattatacatatttttgtaaggaataatgtaaccacaaggaagatatagggagacacgta |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
44221166 |
aaattatggcatgaaatatgtggaaagctcacagtgcaggtattatacatatttttataaggaataatgtaatcacaaggaagatatagggagacacgta |
44221067 |
T |
|
| Q |
109 |
gttttttggtggtgt |
123 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
44221066 |
gttttttggtggtgt |
44221052 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University