View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2218R-Insertion-4 (Length: 600)
Name: NF2218R-Insertion-4
Description: NF2218R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2218R-Insertion-4 |
 | |
|
| [»] chr8 (2 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 267; Significance: 1e-149; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 267; E-Value: 1e-149
Query Start/End: Original strand, 314 - 600
Target Start/End: Original strand, 11612646 - 11612932
Alignment:
| Q |
314 |
agtgtatttatcaaaggataagcttacaagggttatcttagaaattgcttaatgttaaagattttgttatggttggttggtatgactgtgagagtggacc |
413 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
11612646 |
agtgtatttatcaaaggataagcttaaaagggttacattagaaattgcttaatgttaaagattttgttatggttggttggtgtgactgtgagagtggacc |
11612745 |
T |
|
| Q |
414 |
tgttacagttcagctggtctttatcttcaacatgaagccttttttaattttcatgtttctatatagtttggtatgatgtaatctagcttctgcttttgtc |
513 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11612746 |
tgttacagttcagctggtctttatcttcaacatgaagccttttttaattttcatgtttctatatagtttggtatgatgtaatctagcttctgcttttgtc |
11612845 |
T |
|
| Q |
514 |
ctcactctaattgattttgtaaattatttccattgatctagtttcttctgcatgtttggtttgccttttagtcttaaggtccttttc |
600 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11612846 |
ctcactctaattgattttgtaaagtatttccattgatctagtttcttctgcatgtttggtttgccttttagtcttaaggtccttttc |
11612932 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 137; E-Value: 3e-71
Query Start/End: Original strand, 48 - 188
Target Start/End: Original strand, 11612380 - 11612520
Alignment:
| Q |
48 |
tcatatgttagtactctcttctcttttttcatgtgtccctattgattcatagcactatctctttatttcttatgctttactatgctttgaggtgtgaaat |
147 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11612380 |
tcatatgttagtactctcttctcttttttcatgtgtcactattgattcatagcactatctctttatttcttatgctttactatgctttgaggtgtgaaat |
11612479 |
T |
|
| Q |
148 |
atcttttactgcttttcacttaattcaccaaagttcttacc |
188 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11612480 |
atcttttactgcttttcacttaattcaccaaagttcttacc |
11612520 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University