View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2218R-Insertion-7 (Length: 366)
Name: NF2218R-Insertion-7
Description: NF2218R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2218R-Insertion-7 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 288; Significance: 1e-161; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 288; E-Value: 1e-161
Query Start/End: Original strand, 9 - 366
Target Start/End: Complemental strand, 24135204 - 24134851
Alignment:
| Q |
9 |
tgttattgcatagataccttaccgatccgacaatttgtttgaaaattattgaatcgattttcttttcatcagtgttcgtctcataatagagcatcccatg |
108 |
Q |
| |
|
|||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
24135204 |
tgttattgcatagataccttgctgatccgacaatttgtttgaaaattattgaatcgattttcttttcatcagcgttcgtctcataatagagcatcccatg |
24135105 |
T |
 |
| Q |
109 |
actttattggtggggccagtgatttttcacctcttcttggtgggacgagtagttttccacttctccaaagagaggaggaatcacttcccaaggcttatta |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| || |
|
|
| T |
24135104 |
actttattggtggggccagtgatttttcacctctccttggtgggacgagtagttttccacttctccaaagag---aggaatcacttcccaaggcttaata |
24135008 |
T |
 |
| Q |
209 |
gtaattagttcaaaaattcaaatatttttctactatctccaacatggtttgcttggtacgtggtttctccagaattccttgcgaatttttgacgaactat |
308 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||| ||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
24135007 |
gtaattagttcaaaaattcagatatttttctactatctctaacatggttcgcttggtacgtggtttctcgagaattccttgcgaatttttgacgaactat |
24134908 |
T |
 |
| Q |
309 |
ttcttaacagtaccgcgaatcggttcacggttctcaggccacccatgcgaattatgta |
366 |
Q |
| |
|
||| |||||||| |||||| |||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
24134907 |
ttcataacagta-cgcgaaccggttcgcggttctcaggccacccatgcgaattatgta |
24134851 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University