View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2218_high_22 (Length: 319)
Name: NF2218_high_22
Description: NF2218
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2218_high_22 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 240; Significance: 1e-133; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 11 - 302
Target Start/End: Complemental strand, 14244727 - 14244436
Alignment:
| Q |
11 |
gtgagatgaaccaatcctgatgaaccagaggacattgcatgaaaagaagatcagttgactccatgtctttgaagcaaagagggaagattgtgtcaagtgc |
110 |
Q |
| |
|
|||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
14244727 |
gtgacatgaaccaagcctgatgaaccagaggacattgcatgaaaagaagatcagttgactccatgtcttggaagcaaagagggaagattgtgtcaagtgc |
14244628 |
T |
 |
| Q |
111 |
tacaaccctcctacacaagtttcctctcgttggaatgannnnnnnngccagtctccaaacgaaatttctaactctaggtaagtgaatacaccaaatcttc |
210 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||| |||| |||||||| |||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
14244627 |
tacatccctcctacacaagtttcctctcgttggaatgattttttttgccaatctccaaatgaaatttctaactctaggtaagtgaatagaccaaatcttc |
14244528 |
T |
 |
| Q |
211 |
ttccaaatattaccgagagagggagatgaatattctgggagttgggacacctttgtcattagtcattactcagaagatggtaggcagatttt |
302 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14244527 |
ttccaaatattaccgagagagggagatgaatattctgggagttgggacacctttgtcattagtcattactcagaagatggtaggcagatttt |
14244436 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University