View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2218_high_47 (Length: 215)
Name: NF2218_high_47
Description: NF2218
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2218_high_47 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 1 - 206
Target Start/End: Original strand, 33402693 - 33402898
Alignment:
| Q |
1 |
tgattggatttttggtctctggtgattgagttttggaattgaagagcgttagatggtgtagttatgatggttgatgtggctccatgttttgcaaacactc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33402693 |
tgattggatttttggtctctggtgattgaattttggaattgaagagcgttagatggtgtagttatgatggttgatgtggctccatgttttgcaaacactc |
33402792 |
T |
 |
| Q |
101 |
ttgctgtgtctaccattggaatctgatgtcctccacctacgaaggggaagaagtatattttaactgcatcagtttcatggttcatgttgaaatggagatg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33402793 |
ttgctgtgtctaccattggaatctgatgtcctccacctacgaaggggaagaagtatattttaactgcatcagtttcatggttcatgttgaaatggagatg |
33402892 |
T |
 |
| Q |
201 |
atgatg |
206 |
Q |
| |
|
|||||| |
|
|
| T |
33402893 |
atgatg |
33402898 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University