View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2218_high_50 (Length: 204)
Name: NF2218_high_50
Description: NF2218
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2218_high_50 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 121; Significance: 3e-62; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 121; E-Value: 3e-62
Query Start/End: Original strand, 18 - 189
Target Start/End: Complemental strand, 46549571 - 46549400
Alignment:
| Q |
18 |
agttatagtcactccaaactttatagtagatcaatcctgcacatcattcattgnnnnnnnnnnnnnnnnnggcttgtgataactataaacatttatttta |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
46549571 |
agttatagtcactccaaactttatagtagatcaatcctgcacatcattcattgttttttattttacttttggcttgtgataactataaacatttatttta |
46549472 |
T |
 |
| Q |
118 |
tggatcccaaaatcccacatttcaccatatgcaaaaactttaatgggtcactctctaaaacattgacctatg |
189 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46549471 |
tggatcccaaaatcccacatttcaccatatgcaaaaactttaatgggtcactctctaaaacattgacctatg |
46549400 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University