View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2218_low_25 (Length: 354)
Name: NF2218_low_25
Description: NF2218
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2218_low_25 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 332; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 332; E-Value: 0
Query Start/End: Original strand, 1 - 344
Target Start/End: Original strand, 53603188 - 53603531
Alignment:
| Q |
1 |
tggttttttaattacatgtgatataattgttatccatccatattctaatttgcagcaagattatcactcaagcgtcaattgttgcgttcttcagcaacct |
100 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53603188 |
tggtttttcaattacatgtgatataattgttatccatccatattctaatttgcagcaagattatcactcaagcgtcaattgttgcgttcttcagcaacct |
53603287 |
T |
 |
| Q |
101 |
tgcagatgttggccttcatggttcaatgatggtattttatgattttcaagttttatcatgtattttttaaccttaacttagtttgtgatgccactctatt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53603288 |
tgcagatgttggccttcatggttcaatgatggtatgttatgattttcaagttttatcatgtattttttaaccttaacttagtttgtgatgccactctatt |
53603387 |
T |
 |
| Q |
201 |
ttttgtgtgcagtattacttaaaggctcggtttcattttgataagaatcactttgctgacttaatgatcatttctggtattgcagggactgtgtcacagg |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53603388 |
ttttgtgtgcagtattacttaaaggctcggtttcattttgataagaatcactttgctgacttaatgatcatttctggtattgcagggactgtgtcacagg |
53603487 |
T |
 |
| Q |
301 |
taatttttgtaagaagtgattttagttgtcaaatatcacctatg |
344 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
53603488 |
taatttttgtaagacgtgattttagttgtcaaatatcacctatg |
53603531 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University