View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2218_low_26 (Length: 332)
Name: NF2218_low_26
Description: NF2218
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2218_low_26 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 210; Significance: 1e-115; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 19 - 308
Target Start/End: Complemental strand, 35350996 - 35350688
Alignment:
| Q |
19 |
ctgcttcttagtattagccatgatagttttaatgcttttagtttaaaggtctttgcaatgacattgcaactgtaattgtggctgtataggctgcgtttgt |
118 |
Q |
| |
|
|||||| ||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35350996 |
ctgcttgttagtattagccatggtagttttaatggttttagtttaaaggtctttgcaatgacattgcaactgtaattgtggctgtataggctgcgtttgt |
35350897 |
T |
|
| Q |
119 |
tttgcatttctctacaatattttagtattaggcatgatat-----------------tttagtcacttgtttgtttgcattgtatatcacaaccgtaatt |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
35350896 |
tttgcatttctctacaatattttagtattaggcatgatatagtattaggtatgatattttagtcacttgtttgtttgcattgtatatcacaaccacaatt |
35350797 |
T |
|
| Q |
202 |
tagaacatgattggtattcaaagaaacgaagatgatataaaatagaaaatacgtccttttgctgaattgcatacaaaattcatagtattttatt--actc |
299 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||| |||| |
|
|
| T |
35350796 |
tagaacatgattggtattcaaagaaacgaagataatataaaatagaaaatacgtccttttgctgaattgcagacaaaattcattgtattttatttcactc |
35350697 |
T |
|
| Q |
300 |
tctcgctac |
308 |
Q |
| |
|
||||||||| |
|
|
| T |
35350696 |
tctcgctac |
35350688 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 26 - 103
Target Start/End: Complemental strand, 35335482 - 35335411
Alignment:
| Q |
26 |
ttagtattagccatgatagttttaatgcttttagtttaaaggtctttgcaatgacattgcaactgtaattgtggctgt |
103 |
Q |
| |
|
||||||||||| ||||||||||||||| | ||||||| |||||||||||||||||||||||||||||| ||||| |
|
|
| T |
35335482 |
ttagtattagc-atgatagttttaatggt-----tttaaagatctttgcaatgacattgcaactgtaattgtagctgt |
35335411 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University