View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2218_low_31 (Length: 316)
Name: NF2218_low_31
Description: NF2218
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2218_low_31 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 297; Significance: 1e-167; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 297; E-Value: 1e-167
Query Start/End: Original strand, 1 - 301
Target Start/End: Complemental strand, 34810269 - 34809969
Alignment:
| Q |
1 |
aacatggcaaaaagacaaacaaacctgcaattatatctgccccaccactgatgtacttggagatactatgaacaacaacatcagcaccaagcttcaccgg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34810269 |
aacatggcaaaaagacaaacaaacctgcaattatatctgccccaccactgatgtacttggagatactatgaacaacaacatcagcaccaagcttcaccgg |
34810170 |
T |
 |
| Q |
101 |
cgaaatcaccatcggagtaaaagtattatccaccaccaccgtcacgcctttccgatgcgccaccctacacaactccggtatatttgccaccgagagagta |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34810169 |
cgaaatcaccatcggagtaaaagtattatccaccaccaccgtcacacctttccgatgcgccaccctacacaactccggtatatttgccaccgagagagta |
34810070 |
T |
 |
| Q |
201 |
gggtttgagactgattcaaaatacaaaaccttagtctttccttcgatgatagcttcatcaaccatttcaatatcggaaatctcaacgaacgtggttgtta |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34810069 |
gggtttgagactgattcaaaatacaaaaccttagtctttccttcgatgatagcttcatcaaccatttcaatatcggaaatctcaacgaacgtggttgtta |
34809970 |
T |
 |
| Q |
301 |
t |
301 |
Q |
| |
|
| |
|
|
| T |
34809969 |
t |
34809969 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University