View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2218_low_35 (Length: 283)
Name: NF2218_low_35
Description: NF2218
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2218_low_35 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 252; Significance: 1e-140; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 252; E-Value: 1e-140
Query Start/End: Original strand, 1 - 268
Target Start/End: Original strand, 30428948 - 30429215
Alignment:
| Q |
1 |
gctagaaatagcaaatccagcagtagttgaaatggcaacaagagcaagcaaagcttgcatcgaagaatggggaagatcacctaaagaaatcacacacatt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
30428948 |
gctagaaatagcaaatccagcagtagttgaaatggcaacaagagcaagcaaagcttgcatcgaagaatggggaagatcacctgaagaaatcacacacatt |
30429047 |
T |
 |
| Q |
101 |
gtctatgtctcctcgagcgaaattcgtctacctgggggcgacctttaccttgccaatgaactcggcctaaaaagcgacgttaatcgcgtaatgctctatt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
30429048 |
gtctatgtctcctcgagcgaaattcgtctacctgggggtgacctttaccttgccaatgaactcggcctaaaaagcgatgttaatcgcgtaatgctctatt |
30429147 |
T |
 |
| Q |
201 |
tccttggttgctacggaggtgtaagtggtttacgtgtcgccaaagacatcgctgaaaataatcctggt |
268 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30429148 |
tccttggttgctacggaggtgtcagtggtttacgtgtcgccaaagacatcgctgaaaataatcctggt |
30429215 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University