View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2218_low_37 (Length: 275)

Name: NF2218_low_37
Description: NF2218
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2218_low_37
NF2218_low_37
[»] chr4 (2 HSPs)
chr4 (53-262)||(55133168-55133376)
chr4 (200-250)||(32183283-32183333)
[»] chr1 (9 HSPs)
chr1 (93-247)||(30465094-30465247)
chr1 (186-261)||(12172946-12173022)
chr1 (142-258)||(42442077-42442193)
chr1 (132-252)||(26384900-26385018)
chr1 (200-247)||(8463050-8463097)
chr1 (200-250)||(43268682-43268732)
chr1 (200-250)||(47028937-47028987)
chr1 (200-258)||(28447722-28447781)
chr1 (200-250)||(46757312-46757362)
[»] chr3 (8 HSPs)
chr3 (186-261)||(31525355-31525431)
chr3 (200-250)||(28956952-28957002)
chr3 (200-250)||(9358826-9358876)
chr3 (200-250)||(47820904-47820954)
chr3 (200-250)||(55166899-55166949)
chr3 (200-260)||(53349407-53349468)
chr3 (200-250)||(28934813-28934861)
chr3 (200-250)||(8431494-8431543)
[»] chr8 (4 HSPs)
chr8 (186-261)||(5200547-5200623)
chr8 (142-258)||(40930898-40931012)
chr8 (200-261)||(10124866-10124929)
chr8 (201-252)||(13959296-13959347)
[»] chr7 (5 HSPs)
chr7 (200-250)||(46691925-46691975)
chr7 (186-250)||(41702856-41702920)
chr7 (200-258)||(49035924-49035983)
chr7 (200-261)||(1039129-1039191)
chr7 (200-258)||(30655667-30655727)
[»] chr6 (4 HSPs)
chr6 (200-250)||(15859101-15859151)
chr6 (200-250)||(33112794-33112844)
chr6 (189-252)||(6575716-6575779)
chr6 (200-261)||(11546772-11546834)
[»] chr5 (4 HSPs)
chr5 (200-250)||(9931879-9931929)
chr5 (200-261)||(10431063-10431125)
chr5 (200-252)||(819204-819254)
chr5 (200-249)||(25539825-25539873)
[»] chr2 (2 HSPs)
chr2 (200-250)||(14732417-14732467)
chr2 (200-250)||(41378275-41378325)


Alignment Details
Target: chr4 (Bit Score: 122; Significance: 1e-62; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 53 - 262
Target Start/End: Complemental strand, 55133376 - 55133168
Alignment:
Q  53 cgtaaacttcacagatactattcatttgnnnnnnnnnnnnagcaggataggttgttaggggtgatgcaagggtatgctttgtggtttaccataggtatat 152  Q
    ||||||||||||||||||||||||||||            |||||||||||||||||||||||| ||||||||||| || ||| |||   ||||||||||    
T  55133376 cgtaaacttcacagatactattcatttgtttttattttttagcaggataggttgttaggggtgacgcaagggtatgatt-gtgctttgttataggtatat 55133278  T
Q  153 gcctgtgtcatcactcgttttgggttgtttcaattgtttaaggatgatttttaaggggtttttgttcgagctgatgtttgtgtggcaaccgatttccctt 252  Q
    ||||||||||||||||||||||||||||| |||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||| | |||||||||    
T  55133277 gcctgtgtcatcactcgttttgggttgttccaattgtttaaggatggtttttaaagggtttttgttcgagctgatgtttgtgtggcaatcaatttccctt 55133178  T
Q  253 gtttgttttc 262  Q
    ||||||||||    
T  55133177 gtttgttttc 55133168  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 200 - 250
Target Start/End: Original strand, 32183283 - 32183333
Alignment:
Q  200 tttttaaggggtttttgttcgagctgatgtttgtgtggcaaccgatttccc 250  Q
    |||| ||||||||||||||||||| | ||||||| ||||||||||||||||    
T  32183283 ttttaaaggggtttttgttcgagccggtgtttgtatggcaaccgatttccc 32183333  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 64; Significance: 5e-28; HSPs: 9)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 64; E-Value: 5e-28
Query Start/End: Original strand, 93 - 247
Target Start/End: Complemental strand, 30465247 - 30465094
Alignment:
Q  93 agcaggataggttgttagg-ggtgatgcaagggtatgctttgtggtttaccataggtatatgcctgtgtcatcactcgttttgggttgtttcaattgttt 191  Q
    ||||||||||| |||| || ||||| |||||||||||||| |||||||  |||||||||||||||   ||||||||| |||||| ||||| |||||||||    
T  30465247 agcaggataggctgtttggtggtgacgcaagggtatgctt-gtggtttgtcataggtatatgccttcatcatcactc-ttttggtttgttccaattgttt 30465150  T
Q  192 aaggatgatttttaaggggtttttgttcgagctgatgtttgtgtggcaaccgattt 247  Q
    | || |  ||||||||||||||||||||||||| ||||  ||||||||||||||||    
T  30465149 atgggtagtttttaaggggtttttgttcgagctaatgtacgtgtggcaaccgattt 30465094  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 57; E-Value: 7e-24
Query Start/End: Original strand, 186 - 261
Target Start/End: Original strand, 12172946 - 12173022
Alignment:
Q  186 ttgtttaaggatgatttttaaggggtttttgttcgagctgatgtttgtgtggcaaccgattt-cccttgtttgtttt 261  Q
    |||||| ||| || |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||    
T  12172946 ttgttttagggtggtttttaaggggtttttgttcgagctgatgtttgtgtggcaaccgatttccccttgtttgtttt 12173022  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 142 - 258
Target Start/End: Complemental strand, 42442193 - 42442077
Alignment:
Q  142 cataggtatatgcctgtgtcatcactcgttttgggttgtttcaattgtttaaggatgatttttaaggggtttttgttcgagctgatgtttgtgtggcaac 241  Q
    |||| |||||||| |||||||| |||| | ||||||||||||  ||||||| || || |||||||||||||||||||||||  | |||||   |||||||    
T  42442193 cataagtatatgcttgtgtcattactc-tattgggttgtttcctttgtttaggggtggtttttaaggggtttttgttcgagtcggtgttttaatggcaac 42442095  T
Q  242 cgatttccc-ttgtttgt 258  Q
    ||||||||| ||||||||    
T  42442094 cgatttcccgttgtttgt 42442077  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 132 - 252
Target Start/End: Original strand, 26384900 - 26385018
Alignment:
Q  132 tgtggtttaccataggtatatgcctgtgtcatcactcgttttgggttgtttcaattgtttaaggatgatttttaaggggtttttgttcgagctgatgttt 231  Q
    ||||||||  |||| ||||||||||| ||||| |||| |||| ||||||| |  || |||| || || ||||||||||| ||||||| |||||| |||||    
T  26384900 tgtggtttgtcatatgtatatgcctgcgtcattactc-ttttaggttgttcct-ttctttaggggtggtttttaagggggttttgtttgagctggtgttt 26384997  T
Q  232 gtgtggcaaccgatttccctt 252  Q
    || || |||||||||||||||    
T  26384998 gtatgacaaccgatttccctt 26385018  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #5
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 200 - 247
Target Start/End: Complemental strand, 8463097 - 8463050
Alignment:
Q  200 tttttaaggggtttttgttcgagctgatgtttgtgtggcaaccgattt 247  Q
    |||||||||||||||||||||||| || |||| |||||||||||||||    
T  8463097 tttttaaggggtttttgttcgagccgacgtttttgtggcaaccgattt 8463050  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #6
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 200 - 250
Target Start/End: Complemental strand, 43268732 - 43268682
Alignment:
Q  200 tttttaaggggtttttgttcgagctgatgtttgtgtggcaaccgatttccc 250  Q
    |||| ||||||||||||||||||| | |||||||| |||||||||||||||    
T  43268732 ttttaaaggggtttttgttcgagccggtgtttgtgcggcaaccgatttccc 43268682  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #7
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 200 - 250
Target Start/End: Original strand, 47028937 - 47028987
Alignment:
Q  200 tttttaaggggtttttgttcgagctgatgtttgtgtggcaaccgatttccc 250  Q
    |||||||||||||||||||||||| | ||||| || |||||||||||||||    
T  47028937 tttttaaggggtttttgttcgagccggtgtttttgcggcaaccgatttccc 47028987  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #8
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 200 - 258
Target Start/End: Original strand, 28447722 - 28447781
Alignment:
Q  200 tttttaaggggtttttgttcgagctgatgtttgtgtggcaaccga-tttcccttgtttgt 258  Q
    |||||||| |||||||||||| |||||||||| | | |||||||| ||||||||||||||    
T  28447722 tttttaagaggtttttgttcgtgctgatgtttatattgcaaccgattttcccttgtttgt 28447781  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #9
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 200 - 250
Target Start/End: Original strand, 46757312 - 46757362
Alignment:
Q  200 tttttaaggggtttttgttcgagctgatgtttgtgtggcaaccgatttccc 250  Q
    ||||||| |||||||||||||||||| ||||  |||||||| |||||||||    
T  46757312 tttttaaagggtttttgttcgagctggtgttattgtggcaatcgatttccc 46757362  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 49; Significance: 4e-19; HSPs: 8)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 186 - 261
Target Start/End: Original strand, 31525355 - 31525431
Alignment:
Q  186 ttgtttaaggatgatttttaaggggtttttgttcgagctgatgtttgtgtggcaaccgattt-cccttgtttgtttt 261  Q
    |||||| ||| || |||||||||||||||||||||||| | ||||||||||||||||||||| ||||||||||||||    
T  31525355 ttgttttagggtggtttttaaggggtttttgttcgagccgttgtttgtgtggcaaccgatttccccttgtttgtttt 31525431  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 200 - 250
Target Start/End: Original strand, 28956952 - 28957002
Alignment:
Q  200 tttttaaggggtttttgttcgagctgatgtttgtgtggcaaccgatttccc 250  Q
    |||| ||||||||||||||||||| | ||||||||||||||||||||||||    
T  28956952 ttttaaaggggtttttgttcgagccggtgtttgtgtggcaaccgatttccc 28957002  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 200 - 250
Target Start/End: Complemental strand, 9358876 - 9358826
Alignment:
Q  200 tttttaaggggtttttgttcgagctgatgtttgtgtggcaaccgatttccc 250  Q
    |||| ||||||||||||||||||| | |||||||| |||||||||||||||    
T  9358876 ttttaaaggggtttttgttcgagccggtgtttgtgcggcaaccgatttccc 9358826  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 200 - 250
Target Start/End: Original strand, 47820904 - 47820954
Alignment:
Q  200 tttttaaggggtttttgttcgagctgatgtttgtgtggcaaccgatttccc 250  Q
    |||| ||||||||||||||||||| | |||||||| |||||||||||||||    
T  47820904 ttttaaaggggtttttgttcgagccggtgtttgtgcggcaaccgatttccc 47820954  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 200 - 250
Target Start/End: Complemental strand, 55166949 - 55166899
Alignment:
Q  200 tttttaaggggtttttgttcgagctgatgtttgtgtggcaaccgatttccc 250  Q
    ||||||||||||||||||||||||  | ||||||| |||||||||||||||    
T  55166949 tttttaaggggtttttgttcgagccaaagtttgtgcggcaaccgatttccc 55166899  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #6
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 200 - 260
Target Start/End: Original strand, 53349407 - 53349468
Alignment:
Q  200 tttttaaggggtttttgttcgagctgatgtttgtgtggcaaccga-tttcccttgtttgttt 260  Q
    ||||||||||||||||||| |||| | |||||||| ||||||||| |||||||||| |||||    
T  53349407 tttttaaggggtttttgtttgagccggtgtttgtgcggcaaccgattttcccttgtatgttt 53349468  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #7
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 200 - 250
Target Start/End: Complemental strand, 28934861 - 28934813
Alignment:
Q  200 tttttaaggggtttttgttcgagctgatgtttgtgtggcaaccgatttccc 250  Q
    |||||||||||||||||||||||| | ||||  ||||||||||||||||||    
T  28934861 tttttaaggggtttttgttcgagccggtgtt--tgtggcaaccgatttccc 28934813  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #8
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 200 - 250
Target Start/End: Complemental strand, 8431543 - 8431494
Alignment:
Q  200 tttttaaggggtttttgttcgagctgatgtttgtgtggcaaccgatttccc 250  Q
    |||||||||||||||||||||||| | ||||| ||| ||||||||||||||    
T  8431543 tttttaaggggtttttgttcgagccggtgttt-tgttgcaaccgatttccc 8431494  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 45; Significance: 1e-16; HSPs: 4)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 186 - 261
Target Start/End: Complemental strand, 5200623 - 5200547
Alignment:
Q  186 ttgtttaaggatgatttttaaggggtttttgttcgagctgatgtttgtgtggcaaccga-tttcccttgtttgtttt 261  Q
    ||||||| || ||||||||||||||||||||||||||| | |||||||| ||||||||| |||||||||| ||||||    
T  5200623 ttgtttaggggtgatttttaaggggtttttgttcgagccggtgtttgtgcggcaaccgattttcccttgtatgtttt 5200547  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 142 - 258
Target Start/End: Complemental strand, 40931012 - 40930898
Alignment:
Q  142 cataggtatatgcctgtgtcatcactcgttttgggttgtttcaattgtttaaggatgatttttaaggggtttttgttcgagctgatgtttgtgtggcaac 241  Q
    |||| ||||||||||| ||||| |||| ||||||||| || |  ||||||| || || ||||||||| |||||||||||||| | ||||  |||| ||||    
T  40931012 catatgtatatgcctgcgtcataactc-ttttgggtttttccttttgtttaggggtggtttttaaggagtttttgttcgagccgttgtt--tgtgacaac 40930916  T
Q  242 cgattt-cccttgtttgt 258  Q
    |||||| |||||||||||    
T  40930915 cgatttccccttgtttgt 40930898  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 200 - 261
Target Start/End: Original strand, 10124866 - 10124929
Alignment:
Q  200 tttttaaggggtttttgttcgagctgatg-tttgtgtggcaaccgattt-cccttgtttgtttt 261  Q
    |||||||||||||||||||||||| | || |||||  |||||||||||| ||||||||||||||    
T  10124866 tttttaaggggtttttgttcgagccggtgttttgttaggcaaccgatttccccttgtttgtttt 10124929  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 201 - 252
Target Start/End: Complemental strand, 13959347 - 13959296
Alignment:
Q  201 ttttaaggggtttttgttcgagctgatgtttgtgtggcaaccgatttccctt 252  Q
    |||||||||||||||||| |||| | ||||| ||||||||||||||| ||||    
T  13959347 ttttaaggggtttttgtttgagccggtgtttatgtggcaaccgattttcctt 13959296  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 5)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 200 - 250
Target Start/End: Complemental strand, 46691975 - 46691925
Alignment:
Q  200 tttttaaggggtttttgttcgagctgatgtttgtgtggcaaccgatttccc 250  Q
    |||||||||||||||||||||||| | ||||| ||||||||||||||||||    
T  46691975 tttttaaggggtttttgttcgagccggtgtttatgtggcaaccgatttccc 46691925  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 186 - 250
Target Start/End: Original strand, 41702856 - 41702920
Alignment:
Q  186 ttgtttaaggatgatttttaaggggtttttgttcgagctgatgtttgtgtggcaaccgatttccc 250  Q
    ||||||| || || |||||||||||||||||||||||| | |||||||| ||||||||| |||||    
T  41702856 ttgtttagggttggtttttaaggggtttttgttcgagccggtgtttgtgcggcaaccgacttccc 41702920  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 200 - 258
Target Start/End: Complemental strand, 49035983 - 49035924
Alignment:
Q  200 tttttaaggggtttttgttcgagctgatgtttgtgtggcaaccgattt-cccttgtttgt 258  Q
    |||||||||||||||||||||| | | ||||| ||||||||||||||| |||||||||||    
T  49035983 tttttaaggggtttttgttcgaaccggtgtttatgtggcaaccgatttccccttgtttgt 49035924  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 200 - 261
Target Start/End: Complemental strand, 1039191 - 1039129
Alignment:
Q  200 tttttaaggggtttttgttcgagctgatgtttgtgtggcaaccga-tttcccttgtttgtttt 261  Q
    ||||||||||||||||||||||||  | |||||| | |||||||| |||||||||||||||||    
T  1039191 tttttaaggggtttttgttcgagccaaagtttgtattgcaaccgattttcccttgtttgtttt 1039129  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #5
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 200 - 258
Target Start/End: Complemental strand, 30655727 - 30655667
Alignment:
Q  200 tttttaaggggtttttgttcgagctgatgttt-gtgtggcaaccgattt-cccttgtttgt 258  Q
    |||||||| ||||||||||||||  ||| ||| |||||||||||||||| |||||||||||    
T  30655727 tttttaagaggtttttgttcgagtcgatattttgtgtggcaaccgatttccccttgtttgt 30655667  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 35; Significance: 0.0000000001; HSPs: 4)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 200 - 250
Target Start/End: Original strand, 15859101 - 15859151
Alignment:
Q  200 tttttaaggggtttttgttcgagctgatgtttgtgtggcaaccgatttccc 250  Q
    |||| ||||||||||||||||||| | ||||||| ||||||||||||||||    
T  15859101 ttttaaaggggtttttgttcgagccggtgtttgtttggcaaccgatttccc 15859151  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 200 - 250
Target Start/End: Complemental strand, 33112844 - 33112794
Alignment:
Q  200 tttttaaggggtttttgttcgagctgatgtttgtgtggcaaccgatttccc 250  Q
    ||||||||||||||||||||||||  | |||||| ||||||||||||||||    
T  33112844 tttttaaggggtttttgttcgagccaaagtttgtatggcaaccgatttccc 33112794  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 189 - 252
Target Start/End: Original strand, 6575716 - 6575779
Alignment:
Q  189 tttaaggatgatttttaaggggtttttgttcgagctgatgtttgtgtggcaaccgatttccctt 252  Q
    ||||||| || |||||||| ||||||||||||||| ||||||||| || |||| ||||| ||||    
T  6575716 tttaagggtggtttttaagaggtttttgttcgagccgatgtttgtatgacaactgattttcctt 6575779  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 200 - 261
Target Start/End: Original strand, 11546772 - 11546834
Alignment:
Q  200 tttttaaggggtttttgttcgagctgatgtttgtgtggcaaccgatttc-ccttgtttgtttt 261  Q
    ||||||||| |||||||||||||| | ||||||| || ||||||||||| |||| ||||||||    
T  11546772 tttttaaggagtttttgttcgagccggtgtttgtatgacaaccgatttctccttctttgtttt 11546834  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 35; Significance: 0.0000000001; HSPs: 4)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 200 - 250
Target Start/End: Complemental strand, 9931929 - 9931879
Alignment:
Q  200 tttttaaggggtttttgttcgagctgatgtttgtgtggcaaccgatttccc 250  Q
    ||||| ||| |||||||||||||||| |||||||| |||||||||||||||    
T  9931929 tttttgaggtgtttttgttcgagctggtgtttgtgcggcaaccgatttccc 9931879  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 200 - 261
Target Start/End: Original strand, 10431063 - 10431125
Alignment:
Q  200 tttttaaggggtttttgttcgagctgatgtttgtgtggcaaccgatttc-ccttgtttgtttt 261  Q
    |||||| | ||||||||||||||  | |||||||||||||||||||||| |||||||||||||    
T  10431063 tttttatgaggtttttgttcgagtcggtgtttgtgtggcaaccgatttctccttgtttgtttt 10431125  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 200 - 252
Target Start/End: Complemental strand, 819254 - 819204
Alignment:
Q  200 tttttaaggggtttttgttcgagctgatgtttgtgtggcaaccgatttccctt 252  Q
    ||||||||||||||||||||||| || ||||  ||||||||||||||||||||    
T  819254 tttttaaggggtttttgttcgagttggtgtt--tgtggcaaccgatttccctt 819204  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 200 - 249
Target Start/End: Original strand, 25539825 - 25539873
Alignment:
Q  200 tttttaaggggtttttgttcgagctgatgtttgtgtggcaaccgatttcc 249  Q
    |||||||||||||||||||||||| ||||||||  |||||||||||||||    
T  25539825 tttttaaggggtttttgttcgagccgatgtttg-atggcaaccgatttcc 25539873  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 31; Significance: 0.00000002; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 200 - 250
Target Start/End: Complemental strand, 14732467 - 14732417
Alignment:
Q  200 tttttaaggggtttttgttcgagctgatgtttgtgtggcaaccgatttccc 250  Q
    |||||||||||||||||||||||||| | ||| || || ||||||||||||    
T  14732467 tttttaaggggtttttgttcgagctggtatttttgcggtaaccgatttccc 14732417  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 200 - 250
Target Start/End: Complemental strand, 41378325 - 41378275
Alignment:
Q  200 tttttaaggggtttttgttcgagctgatgtttgtgtggcaaccgatttccc 250  Q
    |||| ||||||||||| ||||||| |  |||||||||||||||||||||||    
T  41378325 ttttaaaggggtttttattcgagccggagtttgtgtggcaaccgatttccc 41378275  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University