View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2218_low_39 (Length: 253)
Name: NF2218_low_39
Description: NF2218
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2218_low_39 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 125; Significance: 2e-64; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 18 - 240
Target Start/End: Original strand, 8721716 - 8721917
Alignment:
| Q |
18 |
actttgagattgtggatattgtccaaagaaactataaatagggattgaagtaatatttcaaaagtaggcaggtagtagtagtaagatacagtttccatat |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||| ||| ||| ||||||||| |
|
|
| T |
8721716 |
actttgagattgtggatattgtccaaagaaactataaata---------------tttcaaaagtaggcaggtagtggta---agagacaatttccatat |
8721797 |
T |
 |
| Q |
118 |
tttgtttttgttttagtatatttctttgacttccgagctaagccaaaaatagactgtgatcaccttccatactactcttactcactacttttcaccatta |
217 |
Q |
| |
|
||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8721798 |
tttgtttttgtttta---tatttgtttgacttccgagctaagccaaaaatagactgtgatcaccttccatactactcttactcactacttttcaccatta |
8721894 |
T |
 |
| Q |
218 |
caaattgcagaaccattttctct |
240 |
Q |
| |
|
||||||||||||||| ||||||| |
|
|
| T |
8721895 |
caaattgcagaaccactttctct |
8721917 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University