View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2218_low_45 (Length: 249)
Name: NF2218_low_45
Description: NF2218
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2218_low_45 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 111; Significance: 4e-56; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 111; E-Value: 4e-56
Query Start/End: Original strand, 135 - 249
Target Start/End: Complemental strand, 11612520 - 11612406
Alignment:
| Q |
135 |
ggtaagaactttggtgaattaagtgaaaagcagtaaaagatatttcacacctcaaagcatagtaaagcataagaaataaagagatagtgctatgaatcaa |
234 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11612520 |
ggtaagaactttggtgaattaagtgaaaagcagtaaaagatatttcacacctcaaagcatagtaaagcataagaaataaagagatagtgctatgaatcaa |
11612421 |
T |
 |
| Q |
235 |
tagggacacatgaaa |
249 |
Q |
| |
|
||| ||||||||||| |
|
|
| T |
11612420 |
tagtgacacatgaaa |
11612406 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University