View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2218_low_47 (Length: 240)

Name: NF2218_low_47
Description: NF2218
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2218_low_47
NF2218_low_47
[»] chr2 (1 HSPs)
chr2 (1-231)||(40998229-40998462)


Alignment Details
Target: chr2 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 1 - 231
Target Start/End: Complemental strand, 40998462 - 40998229
Alignment:
1 gatggattgcttggctcttggcccttgggtcaacttaagttttcaaaatgtgtca---cttccgtaaaattgagttagcttgccaaacacttgattatgg 97  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||   | ||||||||||||| ||||| | |||||||||| |||||||    
40998462 gatggattgcttggctcttggcccttgggtcaacttaagttttcaaaatgtgtcatcacctccgtaaaattgaattagcataccaaacacttaattatgg 40998363  T
98 gagttttcaaatggggacggcgagggttgagagtgggggaagagagttgtttgccatggtgtgtttgaatcacgataaatagacaatagcaaggtaatga 197  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |    
40998362 gagttttcaaatggggacggcgagggttgagagtgggggaagagagttgtttgccatggtgtgtttgaatcacgataaatagacaatagcaaggtaataa 40998263  T
198 aaataagatcgaattgatcaatctaagtgatgat 231  Q
    ||||||||||||||||||||||||||||||||||    
40998262 aaataagatcgaattgatcaatctaagtgatgat 40998229  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University