View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2218_low_47 (Length: 240)
Name: NF2218_low_47
Description: NF2218
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2218_low_47 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 1 - 231
Target Start/End: Complemental strand, 40998462 - 40998229
Alignment:
| Q |
1 |
gatggattgcttggctcttggcccttgggtcaacttaagttttcaaaatgtgtca---cttccgtaaaattgagttagcttgccaaacacttgattatgg |
97 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||| ||||| | |||||||||| ||||||| |
|
|
| T |
40998462 |
gatggattgcttggctcttggcccttgggtcaacttaagttttcaaaatgtgtcatcacctccgtaaaattgaattagcataccaaacacttaattatgg |
40998363 |
T |
|
| Q |
98 |
gagttttcaaatggggacggcgagggttgagagtgggggaagagagttgtttgccatggtgtgtttgaatcacgataaatagacaatagcaaggtaatga |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
40998362 |
gagttttcaaatggggacggcgagggttgagagtgggggaagagagttgtttgccatggtgtgtttgaatcacgataaatagacaatagcaaggtaataa |
40998263 |
T |
|
| Q |
198 |
aaataagatcgaattgatcaatctaagtgatgat |
231 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
40998262 |
aaataagatcgaattgatcaatctaagtgatgat |
40998229 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University