View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2218_low_55 (Length: 219)
Name: NF2218_low_55
Description: NF2218
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2218_low_55 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 120; Significance: 1e-61; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 120; E-Value: 1e-61
Query Start/End: Original strand, 1 - 136
Target Start/End: Complemental strand, 2672115 - 2671980
Alignment:
| Q |
1 |
ttgaccgatgagttgaacaaagagttaaaggaggagttgatcaaagaattgaaaaccatgaaggaagagatgacagaggagttgaagaaagggctgaagg |
100 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||| |
|
|
| T |
2672115 |
ttgaccgatgagttgaatgaagagttaaaggaggagttgatcaaagaattgaaaaccatgaaggaagagatgacagaggagttgaaggaagtgctgaagg |
2672016 |
T |
|
| Q |
101 |
aggagttaaaggatgagttgaaggaaaaattgaatg |
136 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
2672015 |
aggagttaaaggatgagttgaaggaaaaattgaatg |
2671980 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 56 - 126
Target Start/End: Complemental strand, 2672210 - 2672140
Alignment:
| Q |
56 |
ccatgaaggaagagatgacagaggagttgaagaaagggctgaaggaggagttaaaggatgagttgaaggaa |
126 |
Q |
| |
|
|||||||||||||| ||| |||||||| |||| ||| | ||||||||||||| ||||| || ||| ||||| |
|
|
| T |
2672210 |
ccatgaaggaagagttgaaagaggagtcgaaggaagagttgaaggaggagttgaaggaagaattggaggaa |
2672140 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University