View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2218_low_59 (Length: 209)
Name: NF2218_low_59
Description: NF2218
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2218_low_59 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 174; Significance: 8e-94; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 174; E-Value: 8e-94
Query Start/End: Original strand, 16 - 197
Target Start/End: Complemental strand, 36309566 - 36309385
Alignment:
| Q |
16 |
cacaggtccaaagaagaaagatcgttctgaaaattctgttgccgttaaaacggtatcagtttggacatcagttagttgttcgtattcgcggtggttgaat |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36309566 |
cacaggtccaaagaagaaagatcgttctgaaaattctgttgccgttaaaacggtatcagtttggacatcagttagttgttcgtattcgcggtggttgaat |
36309467 |
T |
 |
| Q |
116 |
gtgacatgtggaggatctcttgcgtttagaagttctctatgccacgcaggttgaatcggaggttgttttgcaccctatgcta |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
36309466 |
gtgacatgtggaggatctcttgcgtttagaagctctctatgccacgcaggttgaatcggaggttgttttgcaccctttgcta |
36309385 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University