View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2219_low_17 (Length: 267)

Name: NF2219_low_17
Description: NF2219
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2219_low_17
NF2219_low_17
[»] chr8 (1 HSPs)
chr8 (109-199)||(3705784-3705874)


Alignment Details
Target: chr8 (Bit Score: 83; Significance: 2e-39; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 109 - 199
Target Start/End: Original strand, 3705784 - 3705874
Alignment:
109 aaaaagaaaattaaatcatgtcttttttaatcaatggctttatcttttctattttcatattcaatcgtacactttatgtctataatattga 199  Q
    ||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
3705784 aaaaaaaaaattaaatcatgtctttttcaatcaatggctttatcttttctattttcatattcaatcgtacactttatgtctataatattga 3705874  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University