View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2219_low_5 (Length: 473)
Name: NF2219_low_5
Description: NF2219
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2219_low_5 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 146; Significance: 1e-76; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 146; E-Value: 1e-76
Query Start/End: Original strand, 233 - 382
Target Start/End: Complemental strand, 34952431 - 34952282
Alignment:
| Q |
233 |
gttccaatatttccctagcctatgataaaaacaataaaaatcaaatataggattgaacaataattcacctagggagtctcctacttgaaatcgactcttt |
332 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
34952431 |
gttccaatatttccctagcctatgataaaaacaataaaaatcaaatataggattgaacaataactcacctagggagtctcctacttgaaatcgactcttt |
34952332 |
T |
|
| Q |
333 |
tctgcccattgattgtaagggttggcattagggtcacttggagcactcca |
382 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34952331 |
tctgcccattgattgtaagggttggcattagggtcacttggagcactcca |
34952282 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 100; E-Value: 3e-49
Query Start/End: Original strand, 66 - 165
Target Start/End: Complemental strand, 34952598 - 34952499
Alignment:
| Q |
66 |
gcaaaatgcctctttagagagatattttaaccatgaaagaaaaagaaaaacatatatatctttggatttactagttcactaccataagtgcataatttgt |
165 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34952598 |
gcaaaatgcctctttagagagatattttaaccatgaaagaaaaagaaaaacatatatatctttggatttactagttcactaccataagtgcataatttgt |
34952499 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 36; Significance: 0.00000000004; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 299 - 346
Target Start/End: Original strand, 31394612 - 31394659
Alignment:
| Q |
299 |
acctagggagtctcctacttgaaatcgactcttttctgcccattgatt |
346 |
Q |
| |
|
||||||||||||||| |||||||| || |||||||||||||||||||| |
|
|
| T |
31394612 |
acctagggagtctccaacttgaaaacggctcttttctgcccattgatt |
31394659 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University