View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2219_low_9 (Length: 352)
Name: NF2219_low_9
Description: NF2219
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2219_low_9 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 162; Significance: 2e-86; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 162; E-Value: 2e-86
Query Start/End: Original strand, 104 - 277
Target Start/End: Complemental strand, 657311 - 657138
Alignment:
| Q |
104 |
gaatgcatgcctagagaatcgccactttgaagatattgaagatattgagctcaagagaaaggagctggacaaaatgtatcagagtcatgctgtcatgggt |
203 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||| |
|
|
| T |
657311 |
gaatgcatgcctagagaattgccactttgaagatattgaagatattgagctcaagagaaaggagctggactaaatgtatcagagtcatgttgtcatgggt |
657212 |
T |
|
| Q |
204 |
gaggatggacctactattggcagtgaaattgttggtgagctggagactgagtgatttggcataactctgttcat |
277 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
657211 |
gaggatggacctactattggcagtgaaattgttggtgagctggagactgagtgatttggcataactctgttcat |
657138 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University