View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2220_high_29 (Length: 249)
Name: NF2220_high_29
Description: NF2220
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2220_high_29 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 90; Significance: 1e-43; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 18 - 115
Target Start/End: Complemental strand, 26475374 - 26475277
Alignment:
| Q |
18 |
atatgtaaatttacttttaaaaatagagataattcaactcacgatatgcataactttgttctttaaaaatagtttaagattgaatggaggaatcatgg |
115 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26475374 |
atatgtaaatgtacttttaaaaatagagataattcaactcacgacatgcataactttgttctttaaaaatagtttaagattgaatggaggaatcatgg |
26475277 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 157 - 198
Target Start/End: Complemental strand, 26475235 - 26475194
Alignment:
| Q |
157 |
gttagttgataagtgtcaaatttgcttcttcttttttatgtt |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
26475235 |
gttagttgataagtgtcaaatttgcttctttttttttatgtt |
26475194 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 202 - 249
Target Start/End: Original strand, 42886314 - 42886361
Alignment:
| Q |
202 |
ttcacaaacgaatcggttaccattccgcttcaattttcctcaatgatt |
249 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||| |||| |
|
|
| T |
42886314 |
ttcacaaacgaatcggttaccatatcgcttcaattttcctcaacgatt |
42886361 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University