View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2220_high_29 (Length: 249)

Name: NF2220_high_29
Description: NF2220
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2220_high_29
NF2220_high_29
[»] chr6 (2 HSPs)
chr6 (18-115)||(26475277-26475374)
chr6 (157-198)||(26475194-26475235)
[»] chr1 (1 HSPs)
chr1 (202-249)||(42886314-42886361)


Alignment Details
Target: chr6 (Bit Score: 90; Significance: 1e-43; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 18 - 115
Target Start/End: Complemental strand, 26475374 - 26475277
Alignment:
18 atatgtaaatttacttttaaaaatagagataattcaactcacgatatgcataactttgttctttaaaaatagtttaagattgaatggaggaatcatgg 115  Q
    |||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||    
26475374 atatgtaaatgtacttttaaaaatagagataattcaactcacgacatgcataactttgttctttaaaaatagtttaagattgaatggaggaatcatgg 26475277  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 157 - 198
Target Start/End: Complemental strand, 26475235 - 26475194
Alignment:
157 gttagttgataagtgtcaaatttgcttcttcttttttatgtt 198  Q
    |||||||||||||||||||||||||||||| |||||||||||    
26475235 gttagttgataagtgtcaaatttgcttctttttttttatgtt 26475194  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 202 - 249
Target Start/End: Original strand, 42886314 - 42886361
Alignment:
202 ttcacaaacgaatcggttaccattccgcttcaattttcctcaatgatt 249  Q
    |||||||||||||||||||||||  |||||||||||||||||| ||||    
42886314 ttcacaaacgaatcggttaccatatcgcttcaattttcctcaacgatt 42886361  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University