View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2220_high_33 (Length: 237)
Name: NF2220_high_33
Description: NF2220
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2220_high_33 |
 |  |
|
| [»] scaffold0040 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr6 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 1623544 - 1623324
Alignment:
| Q |
1 |
tgatggaaacatggggtttaactggacaacgtgttggtgacttcactctatattgtggtcttcttggcactgcttttctacttttgaagtcttaccatgt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1623544 |
tgatggaaacatggggtttaactggacaacgtgttggtgacttcactctatattgtggtcttcttggcactgcttttctacttttgaagtcttaccatgt |
1623445 |
T |
 |
| Q |
101 |
cacttgcaataccaatgatctagcactttgctctcagattgtcaagtcttgtgatgctgcttctctttcttctaggttaattcaccgtgttttgtattgt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
1623444 |
cacttgcaataccaatgatctagcactttgctctcagattgtcaagtcttgtgatgctgcttctctttcttctaggttcattcaccgtgttttgtattgt |
1623345 |
T |
 |
| Q |
201 |
actgtgtcgtgtctctgtttg |
221 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
1623344 |
actgtgtcgtgtctctgtttg |
1623324 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0040 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: scaffold0040
Description:
Target: scaffold0040; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 7 - 196
Target Start/End: Original strand, 69650 - 69839
Alignment:
| Q |
7 |
aaacatggggtttaactggacaacgtgttggtgacttcactctatattgtggtcttcttggcactgcttttctacttttgaagtcttaccatgtcacttg |
106 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||| ||||||||||| ||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
69650 |
aaacatggggtttaactggacaatgtgttggtgacttcactctctattgtggtctccttggcactgcatttctacttttgaagtcttaccatgtcacttg |
69749 |
T |
 |
| Q |
107 |
caataccaatgatctagcactttgctctcagattgtcaagtcttgtgatgctgcttctctttcttctaggttaattcaccgtgttttgta |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
69750 |
caataccaatgatctagcactttgctctcagattgtcaagtcttgtgatgctgcttctctttcttctaggttcattcaccgtgttttgta |
69839 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University