View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2220_low_24 (Length: 325)
Name: NF2220_low_24
Description: NF2220
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2220_low_24 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 307; Significance: 1e-173; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 307; E-Value: 1e-173
Query Start/End: Original strand, 1 - 311
Target Start/End: Original strand, 53795670 - 53795980
Alignment:
| Q |
1 |
caccaccacctgttctcgaagcacaaccaaaccaaccaaaccccgcaaattcaacttcacctttctctcaaaatatttcactcacagcaccaaaaccaca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53795670 |
caccaccacctgttctcgaagcacaaccaaaccaactaaaccccgcaaattcaacttcacctttctctcaaaatatttcactcacagcaccaaaaccaca |
53795769 |
T |
 |
| Q |
101 |
atcacaatcttccactgatctccccgatggtagccagtggcgttacagtgagtttttaaacgcagtaaaaaagggtaaagttgaacgagttaggttcagt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53795770 |
atcacaatcttccactgatctccccgatggtagccagtggcgttacagtgagtttttaaacgcagtaaaaaagggtaaagttgaacgagttaggttcagt |
53795869 |
T |
 |
| Q |
201 |
aaagacggttctgtccttcaactaaccgccgttgatggccggagagcaaacgttatcgttcccaacgaccctgaccttatcgatattctagcaatgaacg |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53795870 |
aaagacggttctgtccttcaactaaccgccgttgatggccggagagcaaacgttatcgttcccaacgaccctgaccttatcgatattctagcaatgaacg |
53795969 |
T |
 |
| Q |
301 |
gcgttgatatt |
311 |
Q |
| |
|
||||||||||| |
|
|
| T |
53795970 |
gcgttgatatt |
53795980 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University