View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2220_low_29 (Length: 274)
Name: NF2220_low_29
Description: NF2220
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2220_low_29 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 1 - 267
Target Start/End: Original strand, 50572814 - 50573083
Alignment:
| Q |
1 |
cactcccacaactaccacttcctaaggttattcacactgcctattttgggtcattgctgttgttctcaaaatcatcgtcactagccaattgtgcagttgt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50572814 |
cactcccacaactaccacttcctaaggttattcacattgcctattttgggtcattgctgttgttctcaaaatcatcgtcactagccaattgtgcagttgt |
50572913 |
T |
 |
| Q |
101 |
catgattcatggccgctatgggcctaactacttaatgnnnnnnnnnttaagatattattcttaatatttcaaaaatattcatctatacccatcta---at |
197 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||| |||||||||||||||| ||||||| || |
|
|
| T |
50572914 |
catgattcatggccgctatgggcctaactacttaatgaaaaaaaaattaagatattattctttatatttctaaaatattcatctataaccatctaatgat |
50573013 |
T |
 |
| Q |
198 |
gtcagtttattatcaaaacataatctttttgatgatgatttgatttgagtagtgtattctccacaggttc |
267 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||| |
|
|
| T |
50573014 |
gtcagtttgttatcaaaacataatctttttgatgatgatttgacttgagcagtgtattctccacaggttc |
50573083 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University