View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2220_low_37 (Length: 238)
Name: NF2220_low_37
Description: NF2220
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2220_low_37 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 9 - 221
Target Start/End: Original strand, 45908533 - 45908745
Alignment:
| Q |
9 |
gaagaatatgatgatgagaaaattgagaagttctttgccttgataaagagtacaagagatatcctctccaaaacagacaagaaggtgggtgaagnnnnnn |
108 |
Q |
| |
|
|||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45908533 |
gaagaaaatgatgatgagaaaatggagaagttctttgccttgataaagagtacaagagatatcctctccaaaacagacaagaaggtgggtgaagaaaaaa |
45908632 |
T |
 |
| Q |
109 |
nggaaaagtgtatttggaacccaacgtttcaacttgaagatttcattgcttgtgaagaattgggaaagagtaatgtttctgctgcagctggtccttcttc |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45908633 |
aggaaaagtgtatttggaacccaacgtttcaacttgaagatttcattgcttgtgaagaattgggaaagagtaatgtttctgctgcagctggtccttcttc |
45908732 |
T |
 |
| Q |
209 |
acggcaagaaaaa |
221 |
Q |
| |
|
||||||||||||| |
|
|
| T |
45908733 |
acggcaagaaaaa |
45908745 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University