View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2221_high_26 (Length: 256)
Name: NF2221_high_26
Description: NF2221
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2221_high_26 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 18 - 244
Target Start/End: Complemental strand, 48430689 - 48430463
Alignment:
| Q |
18 |
aagaagagtaggcaagtttttctggaaatcttaacaaagtttatggagctttatcaatgcttttgattcaattttctctgtgcatatttgaattcttcaa |
117 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48430689 |
aagaagagcaggcaagtttttctggaaatcttaacaaagtttatggagctttatcaatgcttttgattcaattttctctgtgcatatttgaattcttcaa |
48430590 |
T |
 |
| Q |
118 |
catcaacaggtggccaggggaaaggcaattttggctagtgcaagggaacttgaggatgaattatttggagagatgcaaacagttggaggctgagttacat |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48430589 |
catcaacaggtggccaggggaaaggcaattttggctagtgcaagggaacttgaggctgaattatttggagagatgcaaacagttggaggctgagttacat |
48430490 |
T |
 |
| Q |
218 |
aaagggtgtcagaatagtcaactgatg |
244 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
48430489 |
gaagggtgtcagaatagtcaactgatg |
48430463 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 15 - 88
Target Start/End: Complemental strand, 52805697 - 52805622
Alignment:
| Q |
15 |
atcaagaagagtaggcaagttt-ttctggaaatcttaacaaagtttatggagc-tttatcaatgcttttgattcaa |
88 |
Q |
| |
|
|||||||||| ||||||||| ||||| ||||||||||||||| |||| ||| |||| ||||||||||||||||| |
|
|
| T |
52805697 |
atcaagaagacacggcaagtttcttctgcaaatcttaacaaagtctatgtagcctttagcaatgcttttgattcaa |
52805622 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 31; Significance: 0.00000002; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 27 - 61
Target Start/End: Original strand, 34114494 - 34114528
Alignment:
| Q |
27 |
aggcaagtttttctggaaatcttaacaaagtttat |
61 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| |
|
|
| T |
34114494 |
aggcaagtttttctggaaatgttaacaaagtttat |
34114528 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 27 - 60
Target Start/End: Original strand, 34148677 - 34148710
Alignment:
| Q |
27 |
aggcaagtttttctggaaatcttaacaaagttta |
60 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||| |
|
|
| T |
34148677 |
aggcaagtttttctggaaatgttaacaaagttta |
34148710 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 27 - 60
Target Start/End: Original strand, 34161293 - 34161326
Alignment:
| Q |
27 |
aggcaagtttttctggaaatcttaacaaagttta |
60 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||| |
|
|
| T |
34161293 |
aggcaagtttttctggaaatgttaacaaagttta |
34161326 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University