View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2221_high_29 (Length: 252)

Name: NF2221_high_29
Description: NF2221
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2221_high_29
NF2221_high_29
[»] chr1 (1 HSPs)
chr1 (1-236)||(38924818-38925054)


Alignment Details
Target: chr1 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 1 - 236
Target Start/End: Original strand, 38924818 - 38925054
Alignment:
1 ggtggaattggaactgagtcagaatgatgacaaggtgtaaatttgacaggttttggttttggttctttacttgtttcttactctatcnnnnnnnngtcat 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||        |||||    
38924818 ggtggaattggaactgagtcagaatgatgacaaggtgtaaatttgacaagttttggttttggttctttacttgtttcttactctatcttttttttgtcat 38924917  T
101 tttattctatggttagggatattgcaatattgtatacttt-ggcagaattgtgataaacccgtggccaatattgtaatgatgatgtattattgctcaact 199  Q
    |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
38924918 tttattctatggttagggatattgcaatattgtatacttttggcagaattgtgataaacccgtggccaatattgtaatgatgatgtattattgctcaact 38925017  T
200 tgttgataatcacttctttaataaggcttattgatct 236  Q
    |||||||||||||||||||||||||||||||||||||    
38925018 tgttgataatcacttctttaataaggcttattgatct 38925054  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University