View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2221_high_34 (Length: 239)
Name: NF2221_high_34
Description: NF2221
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2221_high_34 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 15996997 - 15996777
Alignment:
| Q |
1 |
tggcgtaatgaatcagaaaatttctcatcaactttaggtctagagttttatgctctgaataaagttatactgagatcggtgaaccacgaatagtttcagc |
100 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
15996997 |
tggcgtaatgaatctgaaaatttctcatcaactttaggtctagagttttatgctctgaataaagttatactgagatcggtgaaccacgaatagttttagc |
15996898 |
T |
|
| Q |
101 |
aatgtcattaatattattcatgcatgtgatggggcaatcagcagtagagaaacagaaaacgctgaacaatcacaagtattgcaacacgtctgcctgttat |
200 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||| || ||||||||| || |
|
|
| T |
15996897 |
aatgtcattaatattattcacgcatgtgatggggcaatcagcacaagagaaacagaaagcgctgaacaatcacaagtattgcagtacatctgcctgtcat |
15996798 |
T |
|
| Q |
201 |
attttggtggcagtgccatag |
221 |
Q |
| |
|
|||||| ||| |||||||||| |
|
|
| T |
15996797 |
attttgatggtagtgccatag |
15996777 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University