View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2221_high_36 (Length: 237)
Name: NF2221_high_36
Description: NF2221
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2221_high_36 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 199; Significance: 1e-108; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 1 - 222
Target Start/End: Complemental strand, 2808987 - 2808765
Alignment:
| Q |
1 |
aaatttcatattaccctgagtaattcatgattagtttaggtaattaagtggatgttattcatactcaactttgcagtgccctcctgcttacttgagtgac |
100 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2808987 |
aaatttcatattaccccgagtaattcatgattagtttaggtaattaagtggatgttattcatactcaactttgcagtgccctcctgcttacttgagtgac |
2808888 |
T |
 |
| Q |
101 |
actcaaattgaaattctcatcaagtggaaacctcctaagttatttcaaaattaatattgatggatccaattacatttatttcggtaactcgtattgt-gt |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||| || |
|
|
| T |
2808887 |
actcaaattgaaattctcatcaagtggaaacctcctaagttatttcaaaattaatattgatggatccaattacatttctttcggtaactcctattgtggt |
2808788 |
T |
 |
| Q |
200 |
gacctttttcgcgactcaatagt |
222 |
Q |
| |
|
|||||||||||||||| |||||| |
|
|
| T |
2808787 |
gacctttttcgcgacttaatagt |
2808765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 6 - 43
Target Start/End: Complemental strand, 2814084 - 2814047
Alignment:
| Q |
6 |
tcatattaccctgagtaattcatgattagtttaggtaa |
43 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
2814084 |
tcatattaccctgagcaattcatgattagtttaggtaa |
2814047 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University