View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2221_high_39 (Length: 226)
Name: NF2221_high_39
Description: NF2221
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2221_high_39 |
 |  |
|
| [»] chr3 (3 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 204; Significance: 1e-111; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 7 - 226
Target Start/End: Complemental strand, 3023184 - 3022966
Alignment:
| Q |
7 |
aactgttcgtttcaatcttgatccatttaatgaatacaacgatgctgacgtatgggaagctttggaaagggcacacatgaaggatgtaatcagaagaaat |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3023184 |
aactgttcgtttcaatcttgatccatttaatgaatacaacgatgctgacgtatgggaagctttggaaagggcacacatgaaggatgtaatcagaagaaat |
3023085 |
T |
 |
| Q |
107 |
caatttggtctatttcttgtttgcataaaactcgttctaagctttatgttaaatttttgcatgatcaagaattcaagactgctcattgattctcaattcg |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3023084 |
caatttggtctatttcttgtttgcataaaactcgttctaagc-ttatgttgaatttctgcatgatcaagaattcaagactgctcattgattctcaattcg |
3022986 |
T |
 |
| Q |
207 |
aaacaattcattttattatt |
226 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
3022985 |
aaacaattcattttattatt |
3022966 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 96; E-Value: 3e-47
Query Start/End: Original strand, 7 - 118
Target Start/End: Complemental strand, 3030383 - 3030272
Alignment:
| Q |
7 |
aactgttcgtttcaatcttgatccatttaatgaatacaacgatgctgacgtatgggaagctttggaaagggcacacatgaaggatgtaatcagaagaaat |
106 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||| |||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3030383 |
aactgttcgtttcaatctcgatccatttaatgaatacaatgatgttgacatatgggaagctttggaaagggcacacatgaaggatgtaatcagaagaaat |
3030284 |
T |
 |
| Q |
107 |
caatttggtcta |
118 |
Q |
| |
|
|||||||||||| |
|
|
| T |
3030283 |
caatttggtcta |
3030272 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 7 - 106
Target Start/End: Complemental strand, 3006672 - 3006573
Alignment:
| Q |
7 |
aactgttcgtttcaatcttgatccatttaatgaatacaacgatgctgacgtatgggaagctttggaaagggcacacatgaaggatgtaatcagaagaaat |
106 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| ||| ||||||||| |||||||||||||||||||||||||| |||| |||||||| ||||||||| |
|
|
| T |
3006672 |
aactgttcgtttcaatctcgatccatttaatgaacacagcgatgctgatttatgggaagctttggaaagggcacacttgaaagatgtaataagaagaaat |
3006573 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 20 - 93
Target Start/End: Complemental strand, 6101485 - 6101412
Alignment:
| Q |
20 |
aatcttgatccatttaatgaatacaacgatgctgacgtatgggaagctttggaaagggcacacatgaaggatgt |
93 |
Q |
| |
|
|||||||||||||||| |||| |||| ||||||||| | ||||||||| |||| || ||||| |||||||||| |
|
|
| T |
6101485 |
aatcttgatccatttactgaacacaatgatgctgacctctgggaagctctggagagagcacatttgaaggatgt |
6101412 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University