View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2221_low_26 (Length: 262)
Name: NF2221_low_26
Description: NF2221
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2221_low_26 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 44 - 244
Target Start/End: Complemental strand, 48320301 - 48320101
Alignment:
| Q |
44 |
taataatgatccatttgcttacaatttagaatcaccagaaaatgatcatcatagtcaacaagtgcatggtggttgtgatgatccttatatgtacaattta |
143 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
48320301 |
taataatgatccatttgcttacaatttagaatcaccagaaaatgatcatcatattcaacaagtgcatggtggttgtaatgatccttatatgtacaattta |
48320202 |
T |
 |
| Q |
144 |
gtaacaccagaaaatcaccatgaatatattcaacaagggcagggtggtaatactgattcattttcggatgttatgttacaacaacatggaaatggtagta |
243 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48320201 |
gtaccaccagaaaatcaccatgaatatattcaacaagggcagggtggtaatactgattcattttcggatgttatgttacaacaacatggaaatggtagta |
48320102 |
T |
 |
| Q |
244 |
c |
244 |
Q |
| |
|
| |
|
|
| T |
48320101 |
c |
48320101 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University