View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2221_low_30 (Length: 253)
Name: NF2221_low_30
Description: NF2221
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2221_low_30 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 90; Significance: 1e-43; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 7 - 108
Target Start/End: Complemental strand, 37434234 - 37434133
Alignment:
| Q |
7 |
aattgctttcatgttattttcataaaatactcgcatatactttctaaaatgtgctcaagactttattgtttcgtttttgaacatttttatccaaatgtct |
106 |
Q |
| |
|
||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
37434234 |
aattgctttcatgttattttcataaaagactcacatatactttctaaaatgtgctcaagactttattgtttcgtttttgaacatttttatccaattgtct |
37434135 |
T |
 |
| Q |
107 |
ac |
108 |
Q |
| |
|
|| |
|
|
| T |
37434134 |
ac |
37434133 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 39 - 100
Target Start/End: Complemental strand, 37438714 - 37438653
Alignment:
| Q |
39 |
gcatatactttctaaaatgtgctcaagactttattgtttcgtttttgaacatttttatccaa |
100 |
Q |
| |
|
|||||||||||||||| | ||||||||||||||||| ||| |||||| |||||||||||||| |
|
|
| T |
37438714 |
gcatatactttctaaattatgctcaagactttattgcttcatttttggacatttttatccaa |
37438653 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 30; Significance: 0.00000009; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 123 - 164
Target Start/End: Original strand, 20129701 - 20129742
Alignment:
| Q |
123 |
gttttgaatgataaatattactatgttaatcattttgttaat |
164 |
Q |
| |
|
|||||||||||||||||||| ||||||||| |||| |||||| |
|
|
| T |
20129701 |
gttttgaatgataaatattagtatgttaattatttggttaat |
20129742 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 123 - 164
Target Start/End: Complemental strand, 22203169 - 22203128
Alignment:
| Q |
123 |
gttttgaatgataaatattactatgttaatcattttgttaat |
164 |
Q |
| |
|
|||||||||||||||||||| ||||||||| |||| |||||| |
|
|
| T |
22203169 |
gttttgaatgataaatattagtatgttaattatttggttaat |
22203128 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University