View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2221_low_30 (Length: 253)

Name: NF2221_low_30
Description: NF2221
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2221_low_30
NF2221_low_30
[»] chr5 (2 HSPs)
chr5 (7-108)||(37434133-37434234)
chr5 (39-100)||(37438653-37438714)
[»] chr6 (2 HSPs)
chr6 (123-164)||(20129701-20129742)
chr6 (123-164)||(22203128-22203169)


Alignment Details
Target: chr5 (Bit Score: 90; Significance: 1e-43; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 7 - 108
Target Start/End: Complemental strand, 37434234 - 37434133
Alignment:
7 aattgctttcatgttattttcataaaatactcgcatatactttctaaaatgtgctcaagactttattgtttcgtttttgaacatttttatccaaatgtct 106  Q
    ||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||    
37434234 aattgctttcatgttattttcataaaagactcacatatactttctaaaatgtgctcaagactttattgtttcgtttttgaacatttttatccaattgtct 37434135  T
107 ac 108  Q
    ||    
37434134 ac 37434133  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 39 - 100
Target Start/End: Complemental strand, 37438714 - 37438653
Alignment:
39 gcatatactttctaaaatgtgctcaagactttattgtttcgtttttgaacatttttatccaa 100  Q
    |||||||||||||||| | ||||||||||||||||| ||| |||||| ||||||||||||||    
37438714 gcatatactttctaaattatgctcaagactttattgcttcatttttggacatttttatccaa 37438653  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 30; Significance: 0.00000009; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 123 - 164
Target Start/End: Original strand, 20129701 - 20129742
Alignment:
123 gttttgaatgataaatattactatgttaatcattttgttaat 164  Q
    |||||||||||||||||||| ||||||||| |||| ||||||    
20129701 gttttgaatgataaatattagtatgttaattatttggttaat 20129742  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 123 - 164
Target Start/End: Complemental strand, 22203169 - 22203128
Alignment:
123 gttttgaatgataaatattactatgttaatcattttgttaat 164  Q
    |||||||||||||||||||| ||||||||| |||| ||||||    
22203169 gttttgaatgataaatattagtatgttaattatttggttaat 22203128  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University