View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2221_low_31 (Length: 252)
Name: NF2221_low_31
Description: NF2221
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2221_low_31 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 1 - 236
Target Start/End: Original strand, 38924818 - 38925054
Alignment:
| Q |
1 |
ggtggaattggaactgagtcagaatgatgacaaggtgtaaatttgacaggttttggttttggttctttacttgtttcttactctatcnnnnnnnngtcat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
38924818 |
ggtggaattggaactgagtcagaatgatgacaaggtgtaaatttgacaagttttggttttggttctttacttgtttcttactctatcttttttttgtcat |
38924917 |
T |
|
| Q |
101 |
tttattctatggttagggatattgcaatattgtatacttt-ggcagaattgtgataaacccgtggccaatattgtaatgatgatgtattattgctcaact |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38924918 |
tttattctatggttagggatattgcaatattgtatacttttggcagaattgtgataaacccgtggccaatattgtaatgatgatgtattattgctcaact |
38925017 |
T |
|
| Q |
200 |
tgttgataatcacttctttaataaggcttattgatct |
236 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38925018 |
tgttgataatcacttctttaataaggcttattgatct |
38925054 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University