View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2221_low_34 (Length: 248)
Name: NF2221_low_34
Description: NF2221
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2221_low_34 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 1 - 229
Target Start/End: Original strand, 24766396 - 24766625
Alignment:
| Q |
1 |
aagcctccagaattggttttgggttcatatgttgcaagtttttcaacttttgtttcataagtattatttccagtcccttttgtatcagatattttgaatc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||| |
|
|
| T |
24766396 |
aagcctccagaattggttttgggttcatatgttgcaagtttttcaacttttgtttcataagtattatttctaatcccttttgtatcagatattttgaatc |
24766495 |
T |
 |
| Q |
101 |
tttttgttgaaacaacattgctgtgtttaattaaattgctctata-ttttttgcatttgtaattagccatgactgcgatttattgttgttatttcagtcn |
199 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
24766496 |
tttttgttgaaacaacattgctgcgtttaattaaattgctctatatttttttgcatttgtaattagccatcactgcgatttattgttgttatttcagtca |
24766595 |
T |
 |
| Q |
200 |
nnnnnngaatacaatgcagtgcgtgtgtgt |
229 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
24766596 |
aaaaaagaatacaatgcagtgcgtgtgtgt |
24766625 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University