View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2221_low_43 (Length: 205)
Name: NF2221_low_43
Description: NF2221
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2221_low_43 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 130; Significance: 1e-67; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 130; E-Value: 1e-67
Query Start/End: Original strand, 18 - 191
Target Start/End: Original strand, 32304437 - 32304609
Alignment:
| Q |
18 |
gattgaaagtcaacgtgtcgatttaaattccttggaaattattggcgcacaaatgagttatataaataaattccttgatactcagctttaggatttatgt |
117 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||| | |||||||||||||||| |
|
|
| T |
32304437 |
gattggaagtcaacgtgtcgatttaaattccttggaaattattggcgcgcaaatgagttatataaacaaattccttgatac-ctgctttaggatttatgt |
32304535 |
T |
|
| Q |
118 |
ataaaatgcttctgactctagatgctattccagtttactaacaatttcggtttcacttaatgcaaattcctttg |
191 |
Q |
| |
|
| ||||||||||||||||| ||||||||| ||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32304536 |
aaaaaatgcttctgactcttgatgctattatagttttctaacaatttcggtttcacttaatgcaaattcctttg |
32304609 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 47; Significance: 5e-18; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 93 - 183
Target Start/End: Complemental strand, 35427334 - 35427245
Alignment:
| Q |
93 |
tgatactcagctttaggatttatgtataaaatgcttctgactctagatgctattccagtttactaacaatttcggtttcacttaatgcaaa |
183 |
Q |
| |
|
|||||||| ||||||||||| |||||||||||||||| |||| |||| | ||||||||| ||||||| ||||||||||||||||||||| |
|
|
| T |
35427334 |
tgatactc-gctttaggattaatgtataaaatgcttccatctcttgatgttgttccagttttctaacaaattcggtttcacttaatgcaaa |
35427245 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 32; Significance: 0.000000004; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 120 - 175
Target Start/End: Original strand, 25421215 - 25421270
Alignment:
| Q |
120 |
aaaatgcttctgactctagatgctattccagtttactaacaatttcggtttcactt |
175 |
Q |
| |
|
||||||||||||| ||| |||||||||||||||| |||| || |||| |||||||| |
|
|
| T |
25421215 |
aaaatgcttctgattcttgatgctattccagttttctaataaattcgatttcactt |
25421270 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University