View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2224_high_10 (Length: 282)

Name: NF2224_high_10
Description: NF2224
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2224_high_10
NF2224_high_10
[»] chr4 (1 HSPs)
chr4 (34-267)||(33887493-33887720)


Alignment Details
Target: chr4 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 34 - 267
Target Start/End: Original strand, 33887493 - 33887720
Alignment:
34 ctgaagaattggaaaagggaaactcatttcgagaatacagaattttgagaaacaaacctctggatctaacggtgtagtgtcgagctccttaacgtcatcg 133  Q
    |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||        
33887493 ctgaggaattggaaaagggaaactcatttcgagaatacagaattttgagaaacaaacctctggatctaacggtgtagtgtcgagctccttaacgtc---- 33887588  T
134 tcgtcggtttcagtaaccttgccggagctgcagcaagtcaacagcggagtgtgatcggagcgaaactcgtcagaagccgacgaaagaatattttctgcag 233  Q
      || ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||    
33887589 --gttggtttcagtaaccttgccggagctgcagcaagtcaacagcggagtgtgatccgagcgaaactcgtcggaagccgacgaaagaatattttctgcag 33887686  T
234 cttcagcgagcgagtttggtagttgatgcttcat 267  Q
    ||||||| ||||||||||||||||||||||||||    
33887687 cttcagctagcgagtttggtagttgatgcttcat 33887720  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University