View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2224_low_11 (Length: 278)
Name: NF2224_low_11
Description: NF2224
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2224_low_11 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 110; Significance: 2e-55; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 20 - 133
Target Start/End: Original strand, 39933465 - 39933578
Alignment:
| Q |
20 |
atggtgtttgatttgatcgaatattgcgaatgagtattgttcatcgtttatgtatagtttctgttgttaccaacacttcactattctgatcaattgaatt |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39933465 |
atggtgtttgatttgatcgaatattgcgaatgagtattgttcatcttttatgtatagtttctgttgttaccaacacttcactattctgatcaattgaatt |
39933564 |
T |
|
| Q |
120 |
gaaacagttgtaaa |
133 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
39933565 |
gaaacagttgtaaa |
39933578 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 82; E-Value: 9e-39
Query Start/End: Original strand, 197 - 278
Target Start/End: Original strand, 39933642 - 39933723
Alignment:
| Q |
197 |
gaccatgctgtgttatatttcttctacggatattgttacttgagaattgttttatggaccccctaattcctcataagccccc |
278 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39933642 |
gaccatgctgtgttatatttcttctacggatattgttacttgagaattgttttatggaccccctaattcctcataagccccc |
39933723 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University