View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2224_low_13 (Length: 247)
Name: NF2224_low_13
Description: NF2224
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2224_low_13 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 134; Significance: 7e-70; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 134; E-Value: 7e-70
Query Start/End: Original strand, 4 - 226
Target Start/End: Complemental strand, 33887322 - 33887117
Alignment:
| Q |
4 |
tctctttattttcacgttcaattttctaacnnnnnnntttgtcactcatcaaatgctacctatatgnnnnnnnnctttgttcagggaagaggagattgat |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||| | |||||||||| |
|
|
| T |
33887322 |
tctctttattttcacgttcaattttctaacaaaaaaatttgtcactcatcaaatgctacctat-----------------tcagggaggcggagattgat |
33887240 |
T |
 |
| Q |
104 |
gaattctttgcaaattttgagagggaagagcggaagagatttgctgagaagtaagaatataataaaactaccacctgctataaattattttaacttttat |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33887239 |
gaattctttgcaaattttgagagggaagagcggaagagatttgctgagaagtaagtatataataaaactaccacctgctataaattattttaacttttat |
33887140 |
T |
 |
| Q |
204 |
tttgaaatgagtgacacaagata |
226 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
33887139 |
tttgaaatgagtgacacaagata |
33887117 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University