View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2225-3-Insertion-22 (Length: 129)
Name: NF2225-3-Insertion-22
Description: NF2225-3
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2225-3-Insertion-22 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 110; Significance: 7e-56; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 110; E-Value: 7e-56
Query Start/End: Original strand, 7 - 127
Target Start/End: Complemental strand, 3427036 - 3426915
Alignment:
| Q |
7 |
aatatagtgtaataggaagaaggtattaatgttgaatgtacgcgatataagttttggtgtctactacagaaaattaggctgtcaatttctagagtttaaa |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3427036 |
aatatagtgtaataggaagaaggtattaatgttgaatgtacgcgatataaattttggtgtctactacagaaaattaggctgtcaatttctagagtttaaa |
3426937 |
T |
 |
| Q |
107 |
taaactca-tttgtctacgtga |
127 |
Q |
| |
|
|||||||| ||||||||||||| |
|
|
| T |
3426936 |
taaactcattttgtctacgtga |
3426915 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University